Sửa chữa máy rửa mặt Foreo, Halio, Nuskin,...Uy tín & Chất lượng

Bài viết xem nhiều

Bạn đã xem

Sửa chữa máy rửa mặt Foreo, Halio, Nuskin,...

Phạm Anh Tú | 06/05/2021

Máy rửa mặt của bạn không lên nguồn? Rung yếu? Sạc không vào? Sửa chữa máy rửa mặt ở đâu uy tín? Địa chỉ sửa chữa máy rửa mặt,...

Có rất nhiều câu hỏi xảy ra khi bỗng dưng máy rửa mặt của bạn có vấn đề sau 1 thời gian sử dụng, bạn mua hàng xách tay không có hoá đơn cũng như không muốn tốn quá nhiều thời gian + chi phí vận chuyển để gửi bảo hành máy rửa mặt.

Đừng lo, trong vài biết này, Living Up giới thiệu tới quý khách hàng dịch vụ sửa chữa máy rửa mặt Foreo, Halio, Nuskin,...Uy tín, chất lượng là ưu tiên hàng đầu của chúng tôi.

1. Máy rửa mặt là gì và công dụng của nó?

Máy rửa mặt là thiết bị rửa mặt có cấu tạo gồm 2 phần là đầu cọ và thân máy. 

Đầu cọ thường được làm bằng silicone nên rất nhẹ nhàng và an toàn cho da, phần thân máy chứa động cơ và pin giúp máy có thể hoạt động.

Trên thị trường có 2 loại máy rửa mặt ở dạng xoay hoặc rung.

Máy rửa mặt sẽ tạo ra các chuyển động, sóng âm xoay tròn theo hình xoắn ốc, theo chiều từ dưới đi lên và từ trong ra ngoài giúp cho các cơ mặt được nâng lên đồng thời lấy hết bụi bẩn, vi khuẩn trong lỗ chân lông ra bên ngoài.

CÔNG DỤNG:

  • Làm sạch da
  • Chống lão hoá
  • Tăng cường tuần hoàn máu

2. Những lỗi thường gặp trong quá trình sử dụng máy rửa mặt FOREO, HALIO, NUSKIN...?

Máy rửa mặt là một thiết bị bền bỉ, thường thì một thiết bị có tuổi thọ lên tới 3~4 năm.

Tuy nhiên, nếu sử dụng máy không đúng cách, sai công năng sẽ dẫn đến những hư hỏng với nhiều mức độ từ nhẹ đến nặng.

Tích luỹ kinh nghiệm sửa chữa máy rửa mặt, Living Up xin gửi đến quý khách hàng một số lỗi thường gặp về máy rửa mặt trong quá trình sửa chữa như sau:

  • Sửa chữa máy rửa mặt không lên nguồn
  • Sửa chữa máy rửa mặt rung không đều
  • Sửa chữa máy rửa mặt không rung
  • Sửa chữa máy rửa mặt sạc pin không lên
  • Sửa chữa máy rửa mặt rung rồi tắt
  • Sửa chữa máy rửa mặt không chạy
  • Sửa chữa máy rửa mặt nhanh hết pin
  • Sửa chữa máy rửa mặt chai pin
  • Sửa chữa máy rửa mặt nút nguồn không hoạt động
  • Sửa chữa máy rửa mặt sạc không vào điện

Một trong những nguyên nhân gây lỗi cho máy rửa mặt được Living Up tổng kết lại là việc sử dụng máy rửa mặt nhưng không vệ sinh thường xuyên, dẫn đến nước vào gây rỉ sét.

Vấn đề này dễ làm chập bảng điện, nặng hơn là cháy IC. 
Ở vị trí người dùng, khi gặp vấn đề với máy rửa mặt của mình, bạn cần đến một đơn vị sửa chữa máy rửa mặt chuyên nghiệp giúp bạn giải quyết nhanh chóng và triệt để vấn đề.

    3. Quy trình tiếp nhận sửa chữa máy rửa mặt tại LivingUp

    Với kinh nghiệm trong suốt 5 năm kinh doanh các sản phẩm máy rửa mặt cũng như sửa chữa, bảo hành cho khách hàng LivingUp đưa ra quy trình tiếp nhận cho khách hàng ở khắp cả nước. Các bước tiếp nhận:

    • Bước 1: Tiếp nhận sản phẩm, ghi phiếu tiếp nhận sản phẩm.
    • Bước 2: Kiểm tra và đánh giá tình trạng lỗi của sản phẩm (Thời gian từ 1-2 ngày làm việc)
    • Bước 3: Báo lại với quý khách về chi phí sửa chữa
    • Bước 4: Gửi lại sản phẩm đã sửa chữa thành công

    4. Dịch vụ sửa chữa máy rửa mặt FOREO, Halio, Nuskin và các thương hiệu khác

    Việc sửa chữa máy rửa mặt FOREO, Halio, Nuskin tại Living Up dựa trên cơ sở kinh nghiệm được tích luỹ trong suốt nhiều năm qua, cùng tâm huyết mạnh mẽ mong muốn đem tới quý khách hàng những sản phẩm chất lượng và bền bì sau khi sửa chữa.

    Mọi thiết bị máy rửa mặt trải qua quá trình sửa chữa thay pin tại Living Up luôn hướng đến sự tối ưu trong chi phí và chất lượng.

    Chúng tôi thể hiện đúng giá trị cao nhất của một dịch vụ sữa chửa là phục hồi thiết bị về trạng thái ban đầu với chi phí tiết kiệm nhất. Tin tưởng sẽ mang đến sự hài lòng tuyệt đối cho quý khách hàng. 

    Mọi chi tiết thắc mắc cần giải đáp, hãy liên hệ ngay với chúng tôi theo thông tin sau

    • Địa chỉ: số 6 ngõ 444 Đội Cấn, Ba Đình, Hà Nội
    • Hotline dịch vụ 0789 555 366
    • Thời gian làm việc: 10h - 17h (T2-T6, nghỉ CN)

    Đối với khách hàng ngoài khu vực Hà Nội, anh chị có thể gửi sản phẩm qua các đơn vị chuyển phát về địa chỉ như trên. Chúng tôi sẽ tiếp nhận và sửa chữa, sau khi sửa chữa thành công sản phẩm sẽ được gửi lại qua các đơn vị vận chuyển.

    5. Chi phí sửa chữa máy rửa mặt

    Thông thường, chi phí sửa chữa máy rửa mặt sẽ phụ thuộc và việc kiểm tra lỗi của máy, giá thành linh kiện phải thay thế, thời gian khắc phục lỗi của máy. Đối với các lỗi thường gặp như máy rửa mặt hỏng pin, hỏng nguồn, hỏng cầu chì, nước vào,...chi phí sửa chữa khoảng 190.000đ - 500.000đ. Đối với những máy hỏng quá nặng và chi phí sửa chữa, thay thế lớn hơn LivingUp sẽ thông báo để khách hàng quyết định có sửa hay không. 

    Một số hình ảnh sản phẩm đã được LivingUp sửa chữa:

    Sửa chữa máy rửa mặt ForeoSửa chữa máy rửa mặt ForeoSửa chữa máy rửa mặt Foreo

     

    24 Thảo luận:
    binh-luan

    Arridge

    31/10/2022

    Other herbs sometimes used for insomnia include lasix iv dose A 32 P end labeled oligomer, ds GATCCGGGGTCACAGTGACCTA, containing one specific ERE with Sau 3A ends, was used as a specific DNA probe

    binh-luan

    Nguyễn Thu Hằng

    26/10/2022

    Máy luna mini 3 bật lên rung 5s ,lúc trc đang dùng bình thường thì pin hết. Sau khi sạc xong máy có hiện tượng rung 5s rồi tắt luôn.

    binh-luan

    Ggg

    28/09/2022

    mình dùng máy của ckeyin mới xài được một tháng tự nhiên đang xài thì tắt mới đầu tưởng hết pin nên sạc thì thấy có đèn nhấp nháy nhưng sau khi sạc đầy rồi thì bật vẫn không lên mình có thử đập vài cái nó rung lên nhưng tắt ko đc nữa đành phải để rung đến khi hết pin luôn, xong mình sạc tiếp lúc bật lên thì đèn vẫn nhấp nháy nhưng ko rung nữa vậy là bị sao ạ

    binh-luan

    Duyên Di

    21/09/2022

    Máy luna 3 của mình sạc thì vẫn thấy sáng đèn nhưng ấn không rung, không biết lí do tại sao và có thể sửa được không? Add tư vấn mình với nha

    binh-luan

    Phượng Nguyễn

    27/08/2022

    Máy mình dùng là foreo mini 3, dạo này máy mih dùng máy cứ rung đc 1,2 nhịp là tự nhiên tắt eung, đèn sáng nhấp nháy. Bật lại thì lại rung đủ 4 nhịp 1phút. Cho mình hỏi lỗi máy là do bị sao ạ?

    Thảo luận về chủ đề này
    Danh mục
    Danh sách so sánh

    Giỏ hàng